Shear stress adaptation of Listeria monocytogenes in mono and dual-species biofilms Krisha Pant *, Jon Palmer , Steve Flint School of Natural Sciences and Food Technology, Massey University, Palmerston North 4442, New Zealand A R T I C L E I N F O Keywords: Filaments Motility Adhesion Knitted biofilm Gene expression A B S T R A C T While the impact of stress on L. monocytogenes associated with food processing has been recognized in planktonic conditions, the available research overlooks the response of this pathogen in the multi-species biofilm, commonly found in food processing and manufacture. The objective of this study was to understand the effect of shear stress on L. monocytogenes in single and dual-species (with P. fluorescens) biofilm formed in a continuous turbulent flow system. In the single-species biofilm, L. monocytogenes was able to form a biofilm under the turbulent flow with cell concentration reaching 5.1 log CFU/cm2 after 48 h, where filamentous cells (27.7 μm in length) were observed. In contrast, there were no visible filaments in the dual-species biofilm, and L. monocytogenes cell concentration was significantly higher (p < 0.001) at 8.7 log CFU/cm2. The cells harvested from single-species L. monocytogenes biofilm formed under turbulent flow showed significantly (p < 0.001) lower motility and higher adhesion compared with cells harvested from planktonic and static conditions. Gene expression analysis showed significant (p < 0.001) downregulation of motB (motility), sigB (stress), and cell division (ftsX and ftsW), and upregulation of mpl (adhesion) and rodA (rod shape), indicating L. monocytogenes adaptation to shear stress. This study provides fundamental information on the multi-species biofilm formation by L. monocytogenes under stress. 1. Introduction Listeria monocytogenes are rod-shaped, non-spore-forming, gram- positive bacteria, and an important foodborne pathogens that commonly cause outbreaks in dairy products (raw milk, ice cream, cheese), meat products (deli meat), fresh fruits (peaches, cantaloupes) (Redding et al., 2024), and vegetables (enoki mushrooms, leafy greens) (Wiktorczyk-Kapischke et al., 2023). They can persist in the food in- dustry, often showing enhanced resistance to adverse conditions such as low temperature (− 1.5 ◦C), low nutrients, acidity (pH: 3.3–4.2), salinity (10 %), and chemicals (lethal/sublethal) (Melian et al., 2022; Papaioannou et al., 2018; Wiktorczyk-Kapischke et al., 2021). These stress adaptations can be the result of quorum sensing between the bacteria (Zhu et al., 2017), upregulation of stress genes, which are regulated by the sigma factor σB (Guerreiro et al., 2020), resulting in the expression of virulence genes, and changes in phenotypic traits (Wiktorczyk-Kapischke et al., 2023). Homeoviscous adaptation for low-temperature survival (Miladi et al., 2013), rod to coccoid shape under nutrient stress (Gao & Liu, 2014), and rod to elongated chains under saline stress (Giotis et al., 2007; Shah & Bergholz, 2020) are some of the examples of stress adaptation by L. monocytogenes. The filamentation of planktonic L. monocytogenes under saline stress has been correlated with the expres- sion of genes related to the upregulation of the min C gene (inhibits septa formation) (Kale et al., 2017), downregulation of lmo2506 (cell divi- sion), lmo2552 (cell wall synthesis), and lmo1376 (NADPH production) (Liu, Miller, et al., 2014). The phenotypic change includes the elonga- tion of cells longer than 4 μm as compared to the ‘normal’ cell length of L. monocytogenes, which is 1–2 μm (Yamaki et al., 2021). L. monocytogenes isolated from conditions of shear stress have higher adhesion to abiotic surfaces (Mendez et al., 2020) and enhanced resis- tance to removal through shear stress (Szlavik et al., 2012; Vázquez- Boland et al., 2001). The formation of filamentous cells under stress results in the underestimation of the L. monocytogenes cell count (Bereksi et al., 2002; Jones et al., 2013). Once the stress factor is removed, rapid proliferation of L. monocytogenes is observed, contributing to foodborne outbreaks (Yamaki et al., 2021). The adaptation designed for one stress factor that aids bacteria in surviving multiple stress factors is known as cross-tolerance. For example, adapting to cold stress aids in the adhesion of the bacteria to * Corresponding author. E-mail address: kpant@massey.ac.nz (K. Pant). Contents lists available at ScienceDirect Food Research International journal homepage: www.elsevier.com/locate/foodres https://doi.org/10.1016/j.foodres.2025.117190 Received 29 May 2025; Received in revised form 28 July 2025; Accepted 30 July 2025 Food Research International 221 (2025) 117190 Available online 5 August 2025 0963-9969/© 2025 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY license ( http://creativecommons.org/licenses/by/4.0/ ). mailto:kpant@massey.ac.nz www.sciencedirect.com/science/journal/09639969 https://www.elsevier.com/locate/foodres https://doi.org/10.1016/j.foodres.2025.117190 https://doi.org/10.1016/j.foodres.2025.117190 http://creativecommons.org/licenses/by/4.0/ stainless steel surfaces and resistance to quaternary ammonium com- pound sanitizer (Miladi et al., 2013). Similarly, the stress resistance obtained in low-temperature growth improves the cross-tolerance to osmolarity stress (Schmid et al., 2009). The stress-tolerance of L. mon- ocytogenes has been positively correlated with the predominance of L. monocytogenes in polymicrobial communities in food processing envi- ronments (FPEs) (Wang et al., 2023). This synergistic interaction of L. monocytogenes with the background microbiota on FPEs enhances bio- film formation and resistance against sanitizers (Gu et al., 2024; Ibus- quiza et al., 2012; Puga et al., 2018). Pang and Yuk (2019) observed higher resistance of L. monocytogenes against environmental stresses when L. monocytogenes was incorporated into P. fluorescens preformed biofilm, indicating the importance of multispecies interactions in bio- film eradication. This can result from the utilization of extracellular matrix components such as exopolysaccharide (EPS) and metabolites produced by the background microbiota, such as P. fluorescens (Flemming et al., 2016; Puga et al., 2018). P. fluorescens is a major spoilage microorganism frequently isolated from dairy surfaces (Maggio et al., 2021) and has been studied extensively for its role in the syner- gistic multispecies biofilm (Puga et al., 2018; Zhou et al., 2024). P. fluorescens has been reported to produce higher proteolytic enzymes in mixed-species biofilm (Teh et al., 2014) harbour weak biofilm formers (Puga et al., 2015) and show enhanced protection of the overall biofilm from desiccation and disinfection (Pang & Yuk, 2019). One important factor is understanding the effect of shear stress on biofilm formation of pathogens such as L. monocytogenes in single and multi-species communities. So far, studies on the stress response of L. monocytogenes are limited to pH, saline, bile, and nutrients and are focused on planktonic cells, disregarding the most common form of bacteria in nature, the biofilm. In the food processing industries, there are unit operations such as fresh-cut in the minimal processing vegeta- bles (MPV) sector (Cunault et al., 2015), storage (transport) tanks in the dairy sector (Alabdullatif, 2024), spray drying systems (Al-Sharify et al., 2025), and flow through stainless-steel tubes (Perni et al., 2006), where the impact of hydrodynamic conditions can be observed (Szlavik et al., 2012). The biofilm formation, composition, structure, and finally the difficulty of removal from the surface are dependent on many factors such as hydrodynamic conditions, properties of the material, nutrient abundance, and temperature (Simões et al., 2022). Flow conditions and nutrient supply to the bacteria are recognized as important variables in biofilm development (Prabhukhot, Eggleton, Kim, & Patel, 2024; Simões et al., 2022; Vázquez-Boland et al., 2001). Previous research has also stated the difficulty in the removal of biofilm formed under flow compared to biofilms formed under static conditions (Vázquez-Boland et al., 2001). This research aims to under- stand the effects of shear stress on the biofilm formation of L. mono- cytogenes and the cross-adaptation it develops because of shear stress. The morphology of L. monocytogenes under turbulent flow in the pres- ence P. fluorescens on industrially relevant stainless-steel surfaces was also studied. 2. Materials and methods 2.1. Bacterial strains and culture media used Pseudomonas fluorescens 2614 (P1) (dairy isolate) collected in March 2019 with access code P1DZ and Listeria monocytogenes H1 (environ- ment-soil isolate) collected in October 1997 with access code H1KP were used for biofilm formation, which are from a previously established culture collection (Food Microbiology Lab, School of Natural Sciences and Food Technology, Massey University, Palmerston North). The bac- teria stored in glycerol stock (− 80 ◦C) were inoculated into tryptone soy broth (TSB) (Difco™, Becton, Dickinson and Company, USA) and incubated at 30 ◦C for 20 h. The bacteria were centrifuged (Sigma® 6–16, John Morris Scientific Ltd., New Zealand) at 3000g for 20 min, and the supernatant was discarded. The cell pellets were resuspended in saline solution (0.85 %) and centrifuged for another 20 min. Finally, the saline solution was discarded, and the cell pellets were redissolved into fresh saline solution. The cell concentration was adjusted to 8 log CFU/mL using a graph of O⋅D600 nm vs. cell concentration (log CFU/mL) (R2 = 0.97) for indi- vidual bacteria. For dual species, each bacterium was adjusted to this cell concentration and added in 1:1 concentration during inoculation, keeping the ratio of media to cells the same as in single species. 2.2. Biofilm formation in static and turbulent conditions Stainless steel coupons (type 316, 2B finish, 2.4 cm2) (Advanced Sheetmetals Ltd., Palmerston North) were used for biofilm formation in static conditions (Skowron et al., 2019). The coupons were passivated (50 % nitric acid at 70 ◦C for 30 min) to generate a chromium oxide coat, followed by washing, drying, and autoclaving (121 ◦C, 15 mins). The sterile coupons were added to 48-well plates (Costar®, Falcon, USA) containing 10 % TSB with a final cell concentration of L. monocytogenes adjusted to 6 log CFU/mL. The plates were incubated at 30 ◦C for 24 h for further analysis of static biofilm. The Centre for Disease Control (CDC) bioreactor (Biosurface Tech- nologies Corporation, USA) was used for single and multispecies biofilm formation under shear stress (Prabhukhot, Eggleton, Vinyard, & Patel, 2024). Each bioreactor consisted of 8 rods (3 coupons in each rod), and the bioreactor was connected to the sterile media influent and waste media effluent. Bacteria in single and dual-species (1:1) were added to 300 mL of sterile media in the bioreactor to fix the starting cell con- centration at 6 log CFU/mL. The sterile media (10 % TSB) was pumped at 5 mL/min according to the bacteria’s doubling time. The CDC bioreactor was run for seven days under continuous flow, at 30 ◦C and 250 rpm using a heating magnetic stir plate (VWR International, U.S.A). Depending on the experiments, rods were taken out at appropriate time intervals for cell concentration analysis, microscopic observations, and genetic analysis. For the dynamics of the biofilm formation in single and dual species, one rod (three coupons) was taken out of the bioreactor every 24 h for 7 days. The blank rod replaced the coupon rod to maintain the flow. The coupons were saline washed to remove planktonic cells, and the cell concentration in the biofilm was estimated using bead beating assay (3 g glass beads (diameter − 5 mm, Sigma-Aldrich, Germany) in 5 mL saline solution, mixed by vortex for 5 min) and plated in selective agar. Pseu- domonas Isolation agar (Difco™, USA) was used to enumerate Pseudo- monas, and Modified Oxford agar (HiMedia, USA) was used to enumerate Listeria from the dual species samples. A similar method was repeated for single-species biofilm as well, where the coupons were sa- line washed, bead-beaten, and plated on tryptone soy agar (TSA). The bioreactors were run for 2 biological replicates for each sample, and each biological replicate consisted of 3 technical replicates. 2.3. Reynolds number for turbulent flow The Reynolds number of the fluid flowing through the bioreactor was determined to estimate the turbulence in the media (Re < 2100-laminar, 2100 < Re < 4000-transient, Re > 4000-turbulent) (Prabhukhot, Eggleton, Kim, & Patel, 2024; Prabhukhot, Eggleton, Vinyard, & Patel, 2024). The Reynolds number was calculated according to the modified equation for the tangential velocity of media in the agitated vessel. Re = v*Dh μ (1) where Re is the Reynold number, v is the hydrodynamic velocity, Dh is the diameter of the annulus given by 2 (Ro-Ri), Ro is the outer radius measured from the impeller center to the inner coupon surface, Ri is the inner radius measured from the impeller center to the outer edge of the impeller, and μ is the kinematic viscosity (1.0023E-06 m2/s). K. Pant et al. Food Research International 221 (2025) 117190 2 2.4. Cross-adaptation: cells from planktonic, static, and turbulent flow The cells were harvested from the biofilm at 48 h incubation time, formed in turbulent flow and static conditions using glass-bead beating in saline solution (5 min), sonication (5 min), and followed by centri- fugation (5 min, 12,000 g) (Niboucha et al., 2022). The cells from the planktonic culture were harvested through centrifugation (5 min, 12,000 g). The supernatant was discarded for both cases, and the cells were washed in saline solution and centrifuged again for 5 min at 12,000 g. The final cell pellet was dissolved in saline solution, and the cell concentration was fixed at 6 log CFU/mL before the following analysis was carried out with the harvested cells. 2.4.1. Motility The motility of the cells harvested from planktonic, static, and tur- bulent flow was observed through swimming agar according to (Li et al., 2018) with modifications. A volume of 2 μL inoculum (6 log CFU/mL) was stabbed into 0.3 % agar in tryptone soy broth (TSB) agar plates, and the diameter of the growth at 30 ◦C after 24 h was measured using a vernier calliper. 2.4.2. Adhesion to stainless-steel surface The variation in the adhesion of L. monocytogenes cells with fila- mentation (shear-stressed cells) and without filamentation (static and planktonic) was observed using stainless steel coupons (Wang et al., 2022). A volume of 100 μL of harvested cells (6 log CFU/mL) was inoculated into 10 % TSB in a 48-well plate and incubated for 5 min at 30 ◦C to investigate the initial attachment of the bacteria harvested from different growth conditions on the stainless steel surface (Rodriguez et al., 2008). After the incubation, the coupons were removed, washed in saline solution, and cells adhered to the stainless-steel surface were enumerated using the glass bead beating method (3 g glass beads in 5 mL saline solution, mixed by vortex for 5 min) and enumerated on TSA using a spread plate method. The relative adhesion of the cells was calculated by dividing the log of the attached bacteria by the log of bacteria in the inoculum (Chae & Schraft, 2000). 2.4.3. Biofilm-forming ability of harvested cells The cells harvested from planktonic culture, static biofilm, and tur- bulent flow biofilms were used as inoculum (adjusted to 6 log CFU/mL) to form biofilm on the stainless-steel coupons (type 316, 2B finish, 2.4 cm2) at 30 ◦C for 24 h in 10 % TSB under static conditions. The cells in the biofilm formed were quantified through the glass bead beating method and enumeration on TSA plates as described above (Section 2.4.2). 2.5. Epifluorescence- morphology of the cells Acridine orange stain (10 g/L) (BDH, England) was used to visualize the cells as a biofilm after 48 h incubation on stainless-steel coupons in the CDC bioreactor and static coupon surfaces and planktonic cells. The coupons were removed from the bioreactor with mono-species L. mon- ocytogenes biofilm at 48 h and washed with saline solution to remove planktonic cells. The washed and air-dried coupons were dipped in ac- ridine orange staining solution for 5 min and washed with saline solu- tion before air-drying and visualization using an epifluorescence microscope (Nikon eclipse Ni, USA) with TRITC (excitation filter 485/ 20 nm and emission filter 500–538 nm) and NIS-elements D software. Five images were captured from each coupon. Three technical replicates were acquired from each biological replicate. Two biological replicates were used for microscopic analysis. The length and width of at least 20 cells were measured for each replicate, and the results were presented as mean ± standard deviation. 2.6. Fluorescence in situ hybridization (FISH) and confocal microscopy Dual-species biofilm samples were collected from the bioreactor at 48 h, stained with a fluorescent probe (Custom Taqman®, Life Tech- nologies, CA, USA) (Kocot & Olszewska, 2020) and counterstained with 4′,6-diamino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scien- tific, USA) and visualised using confocal microscopy (Nikon D-eclipse C1, Japan). Coupons were washed with PBS before fixing in 4 % para- formaldehyde (BDH Limited, Poole, England) for 15 min at room tem- perature. The fixed coupons were treated with lysozyme (1 mg/mL) (Sigma-Aldrich, Belgium) at 37 ◦C for 10 min. The treated coupons were washed with PBS and air-dried before staining with the fluorescent probe at 46 ◦C for 2 h. The coupons were then dipped in wash buffer at 48 ◦C for 15 min before counterstaining with DAPI (1 mg/mL) and in- cubation in the dark at room temperature for 10 min. The coupons were finally washed with PBS and air dried before visualization of the cells using blue channels for DAPI and red channels for the FISH stain. A 60× water immersion lens was used to observe the images. The images were acquired and overlayed using EZ-C1 software (Gold version 3.80 build 860). 2.7. Relative gene expression Based on the observations made above (Section 2.4), the variation in the expression of the genes relating to the motility of the cells (motB), stress (sigB), biofilm formation and adhesion (mpl), rod shape (rodA), and cell division (ftsW and ftsX) was observed for samples collected from static and turbulent flow and compared to planktonic cells (Gao et al., 2024). 16S and rpoB genes were reference genes for this experiment (Table 1). The cells from the static and turbulent flow biofilms were collected using ice-cold, acid-treated glass beads (Sigma, Germany) and phos- phate buffer saline (PBS) mixed by vortex for 5 min, followed by soni- cation for 5 min. The sonicated solution was centrifuged, and the pellets were collected for RNA extraction. The planktonic samples were centrifuged after 24 h incubation (30 ◦C), and cell pellets were collected for further analysis. The RNA was extracted and purified from the planktonic, static, and shear-stressed samples using NucleoSpin® RNA Plus (Macherey-Nagel, Germany). The integrity of the extracted RNA was analysed using a Nanodrop (Jenway, Bibby Scientific Ltd., UK), and Table 1 Primer sequences used for gene expression analysis of Listeria monocytogenes. Gene Primer Sequence References 16S- reference gene Forward ACATCCTTTGACCACTCTGGA (Gao et al., 2024) ​ Reverse CAACATCTCACGACACGAGC ​ rpoB Forward CGTCGTCTTCGTTCTGTTGG (Gao et al., 2024) ​ Reverse GTTCACGAACCACACGTTCC ​ motB Forward TGCAAAAAAATTCGAACAAATGG (Gao et al., 2024) ​ Reverse CTGCCGCGCCTTCCT ​ sigB Forward AAAGAAACGGGTGAACTACTCGAT (Gao et al., 2024) ​ Reverse CAACGCCTCTCGAAGTTTTTTAA ​ mpl Forward CGGTTATCCAGTATTCGGCG (Gao et al., 2024) ​ Reverse TTCCTCTGTGAGTGGAAGCG ​ rodA Forward CTTCCGCTTGGTCTTGTAGC (Liu, Basu, et al., 2014) ​ Reverse CAATGAGCGCAATCGAACTA ​ ftsW Forward GGGATCGCTAGTCTGATTGC (Liu, Miller, et al., 2014) ​ Reverse TACCAAGCATCATCGACAGC ​ ftsX Forward AATGGTTGGATGACCTTTGC (Liu, Miller, et al., 2014) ​ Reverse CGTTGCAAGCTTGTTCATGT ​ K. Pant et al. Food Research International 221 (2025) 117190 3 the A260/A280nm ratio of 1.9 and above was selected for RT-qPCR (LightCycler® 480, Roche Diagnostics, Switzerland). A total volume of 20 μL consisted of SYBR@Green mastermix, primers (forward and reverse), DNA template, and PCR-grade water, and the RT-qPCR con- ditions were set according to Luna® Universal One-step RT-qPCR Kit (New England Biolabs, Ipswich, MA). The fold change was analysed using the 2-ΔΔct for the target genes (Livak & Schmittgen, 2001) with reference gene (16S) as internal control (Table 1). The non-template control (NTC) was tested for each set of primers. 2.8. Statistical analysis The length of the cells in planktonic, static biofilm, and turbulent biofilm samples was measured using ImageJ (ImageJ 1.54 g, National Institute of Health, USA) from the images obtained from the epifluor- escence microscope. The significant differences (p < 0.05) between the samples were analysed using one-way ANOVA (IBM SPSS Statistics 29) and post-hoc analysis using Tukey’s test, and results were represented as mean ± S.D. The relationship between the length of the cells with motility, adhesion to the stainless-steel coupons, and biofilm formation at 24 h was analysed using Pearson’s correlation analysis (IBM SPSS Statistics 29). 3. Results 3.1. Biofilm formation under turbulent flow The Reynolds number of the flowing media in the bioreactor was higher than 4000, confirming turbulent flow in the CDC bioreactor. In the single-species biofilm, the cell concentration of P. fluorescens at 24 h was 6.3 log CFU/cm2, which gradually increased to 7.8 log CFU/cm2 over the next 6 days of incubation. In the single-species, L. monocytogenes showed a gradual increase in cell concentration from 4.7 log CFU/cm2 (day 1) to 6.3 log CFU/cm2 (day 7) (Fig. 1). The biofilm formation of P. fluorescens was similar in dual species (with L. monocytogenes), with cell concentrations ranging from 6.4 to 7.5 log CFU/cm2 during a 7-day incubation period (Fig. 1). Significantly higher growth (p < 0.05) of L. monocytogenes was observed in dual- species, compared to single-species biofilm (Fig. 1). While the cell concentration of Listeria in 24 h biofilm was comparable in single (4.7 log CFU/cm2) and dual-species (5 log CFU/cm2), a significant increase (p < 0.005) was observed at 48 h where the cell concentration of Listeria was significantly higher (p < 0.05) in dual species (8.7 log CFU/cm2) biofilm as compared to its single species counterpart (5.1 log CFU/cm2). After this initial rise over 48 h in dual species, the cell concentration of Listeria remained consistent over 7 days (8.7–9 log CFU/cm2) (Fig. 1). 3.2. Spatial arrangement and morphology of the cells A ‘knitted’ or ‘web’ structure (Fig. 2.A) was observed in 72 h L. monocytogenes single species biofilm formed under turbulent flow, which, under higher magnification, was observed to be overlapping of filaments (Fig. 2.B). While the filament structure was absent in dual- species biofilm formed with P. fluorescens under turbulent flow, a ‘web’ structure was observed (Fig. 3). The average length of the ‘normal’ L. monocytogenes cells in plank- tonic and static biofilm was 1.3 ± 0.2 μm and 1.4 ± 0.2 μm, respectively (p > 0.05). In comparison, the length of the shear-stressed cells observed in the bioreactor reached 27.7 ± 6.2 μm (refer to Fig. 4. C for an example), which increased in length up to 72 h of incubation. The length of the filaments reached as high as 52.3 ± 1.1 μm under the same con- ditions. In dual-species biofilm formed by P. fluorescens and L. mono- cytogenes, filaments were completely absent, with the mean cell length of 1.6 ± 0.3 μm under flow conditions, indicating no morphological changes of L. monocytogenes in the presence of the second bacterium (P. fluorescens) (Fig. 3). Overall, the bacterial width was unaffected (p > 0.05) in all growth conditions in single-species biofilm, ranging 0.48 ± 0.06 μm, 0.46 ± 0.05 μm, and 0.46 ± 0.04 μm for planktonic, static, and 0 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 lo g C F U /c m 2 Incubation time (days) Dual- P1 Dual- LM1 Single P1 Single LM1 Fig. 1. Cell concentration of P. fluorescens (P1) and L. monocytogenes (LM1) in single- and dual-species biofilms formed under turbulent flow in the CDC bioreactor during 7-day incubation at 30 ◦C. 100 µm 10 µm A B Fig. 2. Knitted structure of L. monocytogenes in single-species biofilm formed under turbulent flow (CDC bioreactor) at 30 ◦C for 72 h, observed with epi- fluorescence microscopy and acridine orange staining under two different magnifications: A) 400× and B) 1000×. K. Pant et al. Food Research International 221 (2025) 117190 4 turbulent flow, respectively. A similar observation (p > 0.05) of cell width (0.45 ± 0.07 μm) was made for L. monocytogenes cells in a dual- species biofilm with P. fluorescens. 3.3. Cross-adaptation and correlation The motility of the cells harvested from biofilm formed under tur- bulent flow was significantly lower (p < 0.05) (3.4 ± 0.9 mm) than those harvested from static biofilm (15.3 ± 1.6 mm) and planktonic condi- tions (21 ± 5.6 mm), observed as the diameter of the growth in 0.3 % TSB agar (Fig. 5.B). The motility negatively correlated (Table 2) with the adhesion of the bacteria (5 min) on stainless steel surfaces in 10 % TSB. The highest relative adhesion (p < 0.05) (5 mins) was observed for cells from turbulent flow (66.4 ± 7.6 %) compared to cells harvested from planktonic (51.8 ± 4.3 %) and static systems (51.9 ± 6.7 %) (Fig. 5.A). The higher relative adhesion of cells from turbulent flow resulted in lower cell numbers in biofilms (p < 0.05) in the turbulent flow (6.7 ± 0.07 log CFU/cm2) biofilms compared to static (7.2 ± 0.1 log CFU/cm2) and planktonic systems (7.0 ± 0.1 log CFU/cm2) (Fig. 5.C). Overall, the length of the cells had a positive impact on adhesion and a negative correlation with motility and biofilm formation. Meanwhile, bacteria with higher motility showed reduced adhesion, but this had a weak correlation with biofilm. The bacteria’s adhesion showed a weak negative correlation with biofilm, but the correlation was not statisti- cally significant (Table 2). 3.4. Relative gene expression The cells from the turbulent flow system showed significant (p < 0.001) downregulation of motility gene (motB), stress gene (sigB), and cell division genes (ftsW and ftsX), whereas adhesion gene (mpl) and rod shape determining gene (rodA) were found to be significantly (p < 0.001) upregulated, relative to cells harvested from the planktonic and static system (Fig. 6). 4. Discussion In this study, the cell concentration of L. monocytogenes improved significantly (p < 0.05) in dual-species biofilm compared to its single- species counterpart under turbulent flow during a 7-day incubation period (Fig. 1). L. monocytogenes is a relatively poor biofilm former, and its inability to form biofilm under shear stress has been noted before Fig. 3. Confocal microscopy image (60× immersion lens) showing a web-like structure of L. monocytogenes (red-cyanine red probe) on P. fluorescens (blue- DAPI) layer, observed for a dual-species biofilm formed in a CDC bioreactor at 30 ◦C. Note: the yellow arrows indicate P. fluorescens cells (blue) and the white arrows indicate L. monocytogenes cells (red). (For interpretation of the refer- ences to colour in this figure legend, the reader is referred to the web version of this article.) Fig. 4. L. monocytogenes cells morphology under different conditions. A) Cells in 24 h planktonic culture, B) Cells in 48 h static biofilm, C) Cells in 48 h CDC bioreactor, all incubated at 30 ◦C. K. Pant et al. Food Research International 221 (2025) 117190 5 (Fagerlund et al., 2021). Under turbulent flow, the presence of higher exopolysaccharide-producing bacteria (Pseudomonas) was found to be more impactful in increasing the biofilm formation of L. monocytogenes than the hydrophobicity, surface charge, or the motility of L. monocytogenes (Sasahara & Zottola, 1993). A similar observation was made for Pseudomonas and L. monocytogenes dual-species biofilm formed on the glass coverslips under flow, where improved cell concentration was observed for L. monocytogenes in dual-species compared to its mono- Fig. 5. Observations made for planktonic, static, and shear-stressed cells at 30 ◦C, A) Relative adhesion (%), B) Motility (0.3 % agar), C) Cell count in biofilm (24 h). K. Pant et al. Food Research International 221 (2025) 117190 6 species counterpart (Puga et al., 2018). An observation of the spatial arrangement of the bacteria via confocal microscopy showed that L. monocytogenes cells embed themselves at the bottom of the biofilm, under the protective layer of P. fluorescens, protecting themselves against the shear forces (Puga et al., 2018). In another study of dual- species biofilm formed by L. monocytogenes and P. fragi under a flow system, the L. monocytogenes cells’ mobility was limited to a localised surface area and appeared to be trapped between the P. fragi cells and the EPS matrix, providing protection against the flow (Sasahara & Zot- tola, 1993). Under a different growth condition (static), the cell con- centration of L. monocytogenes decreased (6.7 log CFU/cm2) in dual- species biofilm formed with P. fluorescens compared to its single- species biofilm (7.21 log CFU/cm2), while P. fluorescens maintained its cell concentrations (7.5–7.8 log CFU/cm2), indicating the importance of flow on the behaviour of bacteria in multispecies setups (Pang & Yuk, 2019). The present study observed chain-like filamentation in L. mono- cytogenes cells of the single-species biofilm formed under turbulent flow (Figs. 2 and 4.C), indicating that this adaptation results from high hy- drodynamic shear stress. A similar observation was made for L. innocua cells under shear stress, where elongation of specific cells was noted for several cells adhered to the stainless-steel surface (Perni et al., 2006). In L. monocytogenes, conditional filamentation of bacteria has been attributed to two major conditions: environmental stress and starvation (Karasz, Weaver, Buckley, & Wilhelm, 2022). These conditions trigger DNA lesions, and filamentation has been reported as a response to repair these lesions (Jones et al., 2013), resulting in inadequate cell separation and the visualization of filament structures. The average length of L. monocytogenes conditioned with 10 % NaCl for 3 days was found to be 6.5 ± 3.3 μm (Yamaki et al., 2021), indicating adaptation to salinity stress under sublethal conditions. The plating of the filaments may not necessarily separate the cells during enumeration, leading to an un- derestimation of the total cell count (Giotis et al., 2007). Once fila- mentation is triggered, returning to the ‘normal’ state depends on the type of stress that caused filamentation. For example, alkali-stressed Listeria cells required three hours to revert to normal-sized cells when incubated in fresh media with neutral pH conditions (Giotis et al., 2007), whereas CO2-stressed Listeria cells took longer (2–4 days) to revert to their original morphology (Jydegaard-Axelsen, Aaes-Jørgensen, Koch, Jensen, & Knøchel, 2005). In addition to the filamentous structure, in the present study, a knitted pattern was observed in 48-h biofilms formed by L. monocytogenes in single-species (Fig. 2) and in dual-species (Fig. 3). A similar observation of a ‘web-like’ structure was noted for L. monocytogenes formed under flow and nutrient stress in a microfluidic system (1/10 BHI) (Cherifi, Jacques, Quessy, & Fravalo, 2017) or ‘knitted’ structure in flow cell chambers (1 % TSB) (Rieu et al., 2008). This pattern changed under the lack of nutrient stress (full-strength BHI), revealing layered bacterial structures (Cherifi et al., 2017). In a dual-species biofilm with P. fluorescens, no filamentous structure was observed (Fig. 3) and was accompanied by significantly (p < 0.001) higher cell concentrations of L. monocytogenes (Fig. 1). In the case of layering, the upper layer consists of metabolically active cells, while the lower layer contains metabolically inactive cells, as observed in Lacto- bacillus lactis biofilm (Habimana et al., 2009). This phenomenon has been explained in terms of nutrient access to the top of the biofilm compared to the bottom (Habimana et al., 2011). The predominant nature of other bacteria over L. monocytogenes has been associated with Table 2 Correlation between cell length, motility, adhesion, and biofilm formation (24 h) observed with Pearson’s coefficient. Length Motility Adhesion Biofilm Length 1 − 0.880** 0.869** − 0.758* Motility − 0.880** 1 − 0.846** 0.49 Adhesion 0.869** − 0.846** 1 − 0.415 Biofilm − 0.758* 0.49 − 0.415 1 ** Correlation is significant at the 0.01 level; * Correlation is significant at the 0.05 level. Fig. 6. The relative gene expression (fold change) of cells from the planktonic system, static biofilm, and biofilm formed under turbulent flow. (Different letters represent significant differences between each bar in a triplicate set – ie. For each gene). K. Pant et al. Food Research International 221 (2025) 117190 7 differences in growth rates, which result in the smothering of L. mono- cytogenes into the lower layers of the biofilm, leading to competitive inhibition (Habimana et al., 2011). However, in the present study, in the continuous system with P. fluorescens and L. monocytogenes although P. fluorescens predominated, no competitive inhibition was observed for either bacterium over 7 days (Fig. 1). While adhesion is one of the first steps for biofilm establishment, this study found a weak correlation between adhesion (5 min) and biofilm formation (24 h) in terms of cell concentration (Table 2). A negative correlation was observed between motility and adhesion, resulting in higher adhesion of Listeria in filament forms on the stainless-steel sur- face. In a similar study, L. monocytogenes strains with low or no motility were found to form a higher biofilm at 37 ◦C (Fan et al., 2020). Rapid adhesion provides the bacteria an opportunity to adhere firmly to the surface and form stronger biofilms before the cleaning and disinfection (Wang et al., 2022). In contrast, the adhesion period of 30 min on polystyrene surfaces showed no linear correlation between adherence and motility of L. monocytogenes on polystyrene surfaces (microtiter plate) (Takahashi et al., 2010), indicating the importance of the duration of adherence. The variation could also be the result of surface hydro- phobicity (plastic surfaces). The lack of correlation between L. mono- cytogenes adherence and biofilm formation has been noted before on glass surfaces (3 h) (Chae & Schraft, 2000). A significant downregulation (p < 0.05) of the motB gene was observed in cells harvested from biofilm under static and flow conditions (Fig. 6). The motility of the cells is associated with the regulation of the motB gene, which regulates the flagella rotation, expressing the swim- ming and swarming abilities of the bacteria (Fan et al., 2020) and also regulates chemotaxis protein. The downregulation of motility genes results in the paralysis of flagella, resulting in cells with decreased swimming and swarming properties of the bacteria (Jiang et al., 2025). In the present study, motility was positively associated with adhesion (5 mins) but did not correlate with biofilm formation (24 h) (Fig. 5). Depending on the L. monocytogenes strain, media, and growth temper- ature, a conflicting relationship between motility and biofilm formation can be found in the literature. A positive impact of motility and biofilm formation has been noted for L. monocytogenes (Fan et al., 2020; Gao et al., 2024). In contrast, Dong et al. (2022) observed no impact of motility on the biofilm formation for L. monocytogenes. The significant upregulation of the mpl gene during biofilm formation on stainless steel surfaces has been noted previously, indicating its importance in biofilm formation (Gao et al., 2024). The upregulation of the mpl gene in the present study, corresponded with the significantly higher adhesion (p < 0.05) to the stainless-steel surface for the shear-stressed cells (Fig. 5.B). A significant downregulation of the stress-regulating gene (sigB) was observed for cells collected from shear-stressed conditions compared to cells collected from planktonic conditions (Fig. 6). The stress factor gene, sigB, controls the general stress response (GSR) (Santos et al., 2019) and is assumed to trigger resistance to environmental and anti- biotic stress in L. monocytogenes, resulting in cross-tolerance (Poimenidou et al., 2023). Upregulation of the sigB genes was observed in the presence of flow (van der Veen & Abee, 2010) and NaCl (2 % and 5 %). However, reports also suggest that the stressful condi- tions do not necessarily result in upregulation of sigB, but vary depending on the L. monocytogenes strains, growth stages, and condi- tions (van der Veen & Abee, 2010). Under cold stress, higher expression of stress genes was observed for the biofilm during the mature stage (Santos et al., 2019), in contrast to the study by (Utratna et al., 2014), where the expression was highest in the early stages of biofilm forma- tion. In the present study, the application of hydrodynamic stress in the continuous system corresponds to the constant influx of fresh media into the bioreactor and removal of waste media from the bioreactor, which could negate the nutritional stress that planktonic cells and static cells encounter in a closed system. Additionally, the sigB gene was found to be significantly downregulated in the combined treatment of sodium hy- pochlorite + peroxyacetic acid and hydrogen peroxide + peroxyacetic acid (Byun et al., 2024), and Quercetin (0.2 mM and 0.8 mM) treatment (Vazquez-Armenta et al., 2020), indicating the role of suppression of sigB genes in reduced biofilm formation. The Fts and rodA proteins belong to the family of SEDS (shape, elongation, division, sporulation) proteins (Rismondo et al., 2019). In the present study, significant downregulation of genes (ftsW and ftsX) and upregulation of gene rodA was observed (Fig. 6). This correlated with the microscopic observations of biofilm formed under turbulent flow, which showed the formation of filaments with a mixture of divided and non-divided septa (Fig. 2.B). In a similar study, L. monocytogenes mutant cells lacking the rodA protein were observed to have shorter cell length (1.3 μm) compared to their wild-type strain (1.9 μm), empha- sizing the important role of the rodA gene in maintaining the rod shape (Rismondo et al., 2019). Two hypotheses have been proposed to explain the elongation of cells as the result of upregulation of the rodA gene and downregulation of the ftsW gene. An increase in the concentration of RodA leads to the scarcity of proteins required at the cell division site and hence results in overproduction of peptidoglycan on the lateral wall. The second one is that the overproduction of the RodA protein inhibits the ftsW protein needed for cell division at the site, leading to elongated cells (Rismondo et al., 2019). In another study, downregulation of the cell division gene ftsX was observed along with filamentation as the result of salinity stress (2.35 % NaCl) after 30 days of storage (Liu, Miller, et al., 2014). Additionally, this gene was found to be upregulated when the cell filaments started dividing, observed at 60 and 90 days (Liu, Miller, et al., 2014). The downregulation of cell division genes indicates adaptation to stressful conditions, as observed in the study regarding L. monocytogenes adaptation to a sublethal dose of carnocyclin A (Liu, Basu, et al., 2014). The cell division protein FtsW regulates the genes ftsW, which control the cell division transport system permease protein. Additionally, the rodA gene determines the rod shape and the cell division protein in L. monocytogenes (Liu, Basu, et al., 2014). The role of ftsW and rodA proteins for the cell shape and morphology has previously been observed for many bacteria, such as B. subtilis (Henriques et al., 1998), E. coli (Boyle et al., 1997), and S. pneumoniae. While this study focuses on the multispecies biofilm formation on the stainless steel coupon owing to its widespread use in the food industry, the food industry also uses many different types of materials, poly- tetrafluoroethylene (PTFE) (Giao & Keevil, 2013), ethylene propylene diene monomer rubber (EPDM) (Prabhukhot, Eggleton, Vinyard, & Patel, 2024), polystyrene (Maggio et al., 2021) which were not studied here. Although both static and dynamic flow were studied in 10 % TSB, studies need to be conducted to confirm if similar interactions between P. fluorescens and L. monocytogenes occur in the presence of flow in nutrient-rich or nutrient-limiting conditions. 5. Conclusion The stress adaptation of pathogens has been studied extensively in planktonic cells. This study investigated the stress adaptation of L. monocytogenes in single and dual-species biofilms with morphological and genetic observations under shear stress. The adaptation of L. mon- ocytogenes under shear stress was found to be significantly different in single-species biofilm compared to dual-species (with P. fluorescens), indicating the importance of considering multispecies in stress response. The gene expression analysis of cells at 48 h incubation time showed that the cells had already adapted to the hydrodynamic stress, possibly aided by the constant inflow of fresh nutrients in the bioreactor, as indicated by the downregulation of the stress gene sigB relative to static conditions (Fig. 6). Another important observation was the filamentation of the bacteria as the result of stress adaptation in a single species (Fig. 2B), which has been associated with the underestimation of cells in the food chain, posing a critical food safety risk (Yamaki et al., 2021). The elongation of cells and formation of filaments in L. monocytogenes have been associated with the variation in susceptibility to antimicrobials (Rismondo et al., 2019). This is crucial information to understand the K. Pant et al. Food Research International 221 (2025) 117190 8 behaviour of the pathogen L. monocytogenes on food processing surfaces under different stressors. CRediT authorship contribution statement Krisha Pant: Writing – original draft, Investigation, Formal analysis, Conceptualization. Jon Palmer: Writing – review & editing, Supervi- sion, Methodology, Conceptualization. Steve Flint: Writing – review & editing, Supervision, Resources, Project administration, Methodology. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data availability Data will be made available on request. References Alabdullatif, M. (2024). Evaluating the effects of temperature and agitation on biofilm formation of bacterial pathogens isolated from raw cow milk. BMC Microbiology, 24 (1), 251. https://doi.org/10.1186/s12866-024-03403-4 Al-Sharify, Z. T., Al-Najjar, S. Z., Naser, Z. A., Alsherfy, Z. A. I., & Onyeaka, H. (2025). The impact of fluid flow on microbial growth and distribution in food processing systems. Foods, 14(3), 401. https://doi.org/10.3390/foods14030401 Bereksi, N., Gavini, F., Benezech, T., & Faille, C. (2002). Growth, morphology and surface properties of Listeria monocytogenes Scott a and LO28 under saline and acid environments. Journal of Applied Microbiology, 92(3), 556–565. https://doi.org/ 10.1046/j.1365-2672.2002.01564.x Boyle, D. S., Khattar, M. M., Addinall, S. G., Lutkenhaus, J., & Donachie, W. D. (1997). ftsW is an essential cell-division gene in Escherichia coli. Molecular Microbiology, 24 (6), 1263–1273. https://doi.org/10.1046/j.1365-2958.1997.4091773.x Byun, K.-H., Han, S. H., Choi, M. W., Kim, B.-H., & Ha, S.-D. (2024). Efficacy of disinfectant and bacteriophage mixture against planktonic and biofilm state of Listeria monocytogenes to control in the food industry. International Journal of Food Microbiology, 413, Article 110587. https://doi.org/10.1016/j. ijfoodmicro.2024.110587 Chae, M. S., & Schraft, H. (2000). Comparative evaluation of adhesion and biofilm formation of different Listeria monocytogenes strains. International Journal of Food Microbiology, 62(1–2), 103–111. https://doi.org/10.1016/S0168-1605(00)00406-2 Cherifi, T., Jacques, M., Quessy, S., & Fravalo, P. (2017). Impact of nutrient restriction on the structure of Listeria monocytogenes biofilm grown in a microfluidic system. Frontiers in Microbiology, 8, 864. https://doi.org/10.3389/fmicb.2017.00864 Cunault, C., Faille, C., Bouvier, L., Föste, H., Augustin, W., Scholl, S., Debreyne, P., & Benezech, T. (2015). A novel set-up and a CFD approach to study the biofilm dynamics as a function of local flow conditions encountered in fresh-cut food processing equipments. Food and Bioproducts Processing, 93, 217–223. https://doi. org/10.1016/j.fbp.2014.07.005 Dong, Q., Sun, L., Fang, T., Wang, Y., Li, Z., Wang, X., Wu, M., & Zhang, H. (2022). Biofilm formation of Listeria monocytogenes and Pseudomonas aeruginosa in a simulated chicken processing environment. Foods, 11(13), 1917. https://doi.org/ 10.3390/foods11131917 Fagerlund, A., Langsrud, S., & Møretrø, T. (2021). Microbial diversity and ecology of biofilms in food industry environments associated with Listeria monocytogenes persistence. Current Opinion in Food Science, 37, 171–178. https://doi.org/10.1016/j. cofs.2020.10.015 Fan, Y., Qiao, J., Lu, Z., Fen, Z., Tao, Y., Lv, F., Zhao, H., Zhang, C., & Bie, X. (2020). Influence of different factors on biofilm formation of Listeria monocytogenes and the regulation of cheY gene. Food Research International, 137, Article 109405. https:// doi.org/10.1016/j.foodres.2020.109405 Flemming, H.-C., Wingender, J., Szewzyk, U., Steinberg, P., Rice, S. A., & Kjelleberg, S. (2016). Biofilms: An emergent form of bacterial life. Nature Reviews Microbiology, 14 (9), 563–575. https://doi.org/10.1038/nrmicro.2016.94 Gao, B., Cai, H., Xu, B., Yang, F., Dou, X., Dong, Q., Yan, H., Bu, X., & Li, Z. (2024). Growth, biofilm formation, and motility of Listeria monocytogenes strains isolated from food and clinical samples located in Shanghai (China). Food Research International, 184, Article 114232. https://doi.org/10.1016/j.foodres.2024.114232 Gao, H., & Liu, C. (2014). Biochemical and morphological alteration of Listeria monocytogenes under environmental stress caused by chloramine-T and sodium hypochlorite. Food Control, 46, 455–461. https://doi.org/10.1016/j. foodcont.2014.05.016 Giao, M., & Keevil, C. (2013). Hydrodynamic shear stress to remove Listeria monocytogenes biofilms from stainless steel and polytetrafluoroethylene surfaces. Journal of Applied Microbiology, 114(1), 256–265. https://doi.org/10.1111/ jam.12032 Giotis, E. S., Blair, I. S., & McDowell, D. A. (2007). Morphological changes in Listeria monocytogenes subjected to sublethal alkaline stress. International Journal of Food Microbiology, 120(3), 250–258. https://doi.org/10.1016/j.ijfoodmicro.2007.08.036 Gu, T., Luo, Y., Jia, Z., Meesrison, A., Lin, S., Ventresca, I. J., … Yang, M. (2024). Surface topography and chemistry of food contact substances, and microbial nutrition affect pathogen persistence and symbiosis in cocktail Listeria monocytogenes biofilms. Food Control, 161, Article 110391. https://doi.org/10.1016/j.foodcont.2014.05.016 Guerreiro, D. N., Wu, J., Dessaux, C., Oliveira, A. H., Tiensuu, T., Gudynaite, D., … Johansson, J. (2020). Mild stress conditions during laboratory culture promote the proliferation of mutations that negatively affect sigma B activity in Listeria monocytogenes. Journal of Bacteriology, 202(9). https://doi.org/10.1128/jb.00751-19 Habimana, O., Guillier, L., Kulakauskas, S., & Briandet, R. (2011). Spatial competition with Lactococcus lactis in mixed-species continuous-flow biofilms inhibits Listeria monocytogenes growth. Biofouling, 27(9), 1065–1072. https://doi.org/10.1080/ 08927014.2011.626124 Habimana, O., Meyrand, M., Meylheuc, T., Kulakauskas, S., & Briandet, R. (2009). Genetic features of resident biofilms determine attachment of Listeria monocytogenes. Applied and Environmental Microbiology, 75(24), 7814–7821. https://doi.org/ 10.1128/AEM.01333-09 Henriques, A. O., Glaser, P., Piggot, P. J., & Moran, C. P., Jr. (1998). Control of cell shape and elongation by the rodA gene in Bacillus subtilis. Molecular Microbiology, 28(2), 235–247. https://doi.org/10.1046/j.1365-2958.1998.00766.x Ibusquiza, P. S., Herrera, J. J., Vázquez-Sánchez, D., & Cabo, M. L. (2012). Adherence kinetics, resistance to benzalkonium chloride, and microscopic analysis of mixed biofilms formed by Listeria monocytogenes and Pseudomonas putida. Food Control, 25 (1), 202–210. https://doi.org/10.1016/j.foodcont.2011.10.002 Jiang, L., Yue, Y., Zhong, K., Wu, Y., & Gao, H. (2025). Antibiofilm mechanism of pyrrole-2-carboxylic acid by impairing flagellar motility of Listeria monocytogenes and its application in cheese. Food Control, 168, Article 110974. https://doi.org/ 10.1016/j.foodcont.2024.110974 Jones, T. H., Vail, K. M., & McMullen, L. M. (2013). Filament formation by foodborne bacteria under sublethal stress. International Journal of Food Microbiology, 165(2), 97–110. https://doi.org/10.1016/j.ijfoodmicro.2013.05.001 Jydegaard-Axelsen, A. M., Aaes-Jørgensen, A., Koch, A. G., Jensen, J. S., & Knøchel, S. (2005). Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up-and downshift. International journal of food microbiology, 98(2), 145–155. https://doi.org/10.1016/j.ijfoodmicro.2004.05.019 Kale, S. B., Doijad, S. P., Poharkar, K. V., Garg, S., Pathak, A. D., Raorane, A. V., … Barbuddhe, S. B. (2017). Elucidation of the role of the minC gene in filament formation by Listeria monocytogenes under stress conditions. International Journal of Current Research and Review, 9, 10. https://doi.org/10.7324/IJCRR.2017.99913 Karasz, D. C., Weaver, A. I., Buckley, D. H., & Wilhelm, R. C. (2022). Conditional filamentation as an adaptive trait of bacteria and its ecological significance in soils. Environmental Microbiology, 24(1), 1–17. https://doi.org/10.1111/1462-2920.15871 Kocot, A. M., & Olszewska, M. A. (2020). Interaction of Pseudomonas aeruginosa and Staphylococcus aureus with Listeria innocua in dual species biofilms and inactivation following disinfectant treatments. Lwt, 118, Article 108736. https://doi.org/ 10.1016/j.lwt.2019.108736 Li, T., Wang, D., Liu, N., Ma, Y., Ding, T., Mei, Y., & Li, J. (2018). Inhibition of quorum sensing-controlled virulence factors and biofilm formation in Pseudomonas fluorescens by cinnamaldehyde. International Journal of Food Microbiology, 269, 98–106. https://doi.org/10.1016/j.ijfoodmicro.2018.01.023 Liu, X., Basu, U., Miller, P., & McMullen, L. M. (2014). Stress response and adaptation of Listeria monocytogenes 08-5923 exposed to a sublethal dose of carnocyclin a. Applied and Environmental Microbiology, 80(13), 3835–3841. https://doi.org/10.1128/ AEM.00350-14 Liu, X., Miller, P., Basu, U., & McMullen, L. M. (2014). Sodium chloride-induced filamentation and alternative gene expression of fts, murZ, and gnd in Listeria monocytogenes 08-5923 on vacuum-packaged ham. FEMS Microbiology Letters, 360 (2), 152–156. https://doi.org/10.1111/1574-6968.12599 Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods, 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262 Maggio, F., Rossi, C., Chaves-López, C., Serio, A., Valbonetti, L., Pomilio, F., … Paparella, A. (2021). Interactions between L. monocytogenes and P. Fluorescens in dual-species biofilms under simulated dairy processing conditions. Foods, 10(1), 176. https://doi.org/10.3390/foods10010176 Melian, C., Bentencourt, E., Castellano, P., Ploper, D., Vignolo, G., & Mendoza, L. M. (2022). Biofilm genes expression of Listeria monocytogenes exposed to Latilactobacillus curvatus bacteriocins at 10◦ C. International Journal of Food Microbiology, 370, Article 109648. https://doi.org/10.1016/j.ijfoodmicro.2022.109648 Mendez, E., Walker, D. K., Vipham, J., & Trinetta, V. (2020). The use of a CDC biofilm reactor to grow multi-strain Listeria monocytogenes biofilm. Food Microbiology, 92, Article 103592. https://doi.org/10.1016/j.fm.2020.103592 Miladi, H., Ammar, E., Ben Slama, R., Sakly, N., & Bakhrouf, A. (2013). Influence of freezing stress on morphological alteration and biofilm formation by Listeria monocytogenes: Relationship with cell surface hydrophobicity and membrane fluidity. Archives of Microbiology, 195, 705–715. https://doi.org/10.1007/s00203- 013-0921-7 Niboucha, N., Goetz, C., Sanschagrin, L., Fontenille, J., Fliss, I., Labrie, S., & Jean, J. (2022). Comparative study of different sampling methods of biofilm formed on stainless-steel surfaces in a CDC biofilm reactor. Frontiers in Microbiology, 13, Article 892181. https://doi.org/10.3389/fmicb.2022.892181 Pang, X., & Yuk, H.-G. (2019). Effects of the colonization sequence of Listeria monocytogenes and Pseudomonas fluorescens on survival of biofilm cells under food- K. Pant et al. Food Research International 221 (2025) 117190 9 https://doi.org/10.1186/s12866-024-03403-4 https://doi.org/10.3390/foods14030401 https://doi.org/10.1046/j.1365-2672.2002.01564.x https://doi.org/10.1046/j.1365-2672.2002.01564.x https://doi.org/10.1046/j.1365-2958.1997.4091773.x https://doi.org/10.1016/j.ijfoodmicro.2024.110587 https://doi.org/10.1016/j.ijfoodmicro.2024.110587 https://doi.org/10.1016/S0168-1605(00)00406-2 https://doi.org/10.3389/fmicb.2017.00864 https://doi.org/10.1016/j.fbp.2014.07.005 https://doi.org/10.1016/j.fbp.2014.07.005 https://doi.org/10.3390/foods11131917 https://doi.org/10.3390/foods11131917 https://doi.org/10.1016/j.cofs.2020.10.015 https://doi.org/10.1016/j.cofs.2020.10.015 https://doi.org/10.1016/j.foodres.2020.109405 https://doi.org/10.1016/j.foodres.2020.109405 https://doi.org/10.1038/nrmicro.2016.94 https://doi.org/10.1016/j.foodres.2024.114232 https://doi.org/10.1016/j.foodcont.2014.05.016 https://doi.org/10.1016/j.foodcont.2014.05.016 https://doi.org/10.1111/jam.12032 https://doi.org/10.1111/jam.12032 https://doi.org/10.1016/j.ijfoodmicro.2007.08.036 https://doi.org/10.1016/j.foodcont.2014.05.016 https://doi.org/10.1128/jb.00751-19 https://doi.org/10.1080/08927014.2011.626124 https://doi.org/10.1080/08927014.2011.626124 https://doi.org/10.1128/AEM.01333-09 https://doi.org/10.1128/AEM.01333-09 https://doi.org/10.1046/j.1365-2958.1998.00766.x https://doi.org/10.1016/j.foodcont.2011.10.002 https://doi.org/10.1016/j.foodcont.2024.110974 https://doi.org/10.1016/j.foodcont.2024.110974 https://doi.org/10.1016/j.ijfoodmicro.2013.05.001 https://doi.org/10.1016/j.ijfoodmicro.2004.05.019 https://doi.org/10.7324/IJCRR.2017.99913 https://doi.org/10.1111/1462-2920.15871 https://doi.org/10.1016/j.lwt.2019.108736 https://doi.org/10.1016/j.lwt.2019.108736 https://doi.org/10.1016/j.ijfoodmicro.2018.01.023 https://doi.org/10.1128/AEM.00350-14 https://doi.org/10.1128/AEM.00350-14 https://doi.org/10.1111/1574-6968.12599 https://doi.org/10.1006/meth.2001.1262 https://doi.org/10.3390/foods10010176 https://doi.org/10.1016/j.ijfoodmicro.2022.109648 https://doi.org/10.1016/j.fm.2020.103592 https://doi.org/10.1007/s00203-013-0921-7 https://doi.org/10.1007/s00203-013-0921-7 https://doi.org/10.3389/fmicb.2022.892181 related stresses and transfer to salmon. Food Microbiology, 82, 142–150. https://doi. org/10.1016/j.fm.2019.02.002 Papaioannou, E., Giaouris, E. D., Berillis, P., & Boziaris, I. S. (2018). Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed- culture simulated fish processing conditions and chemical disinfection challenges. International Journal of Food Microbiology, 267, 9–19. https://doi.org/10.1016/j. ijfoodmicro.2017.12.020 Perni, S., Jordan, S. J., Andrew, P. W., & Shama, G. (2006). Biofilm development by Listeria innocua in turbulent flow regimes. Food Control, 17(11), 875–883. https:// doi.org/10.1016/j.foodcont.2005.06.002 Poimenidou, S. V., Caccia, N., Paramithiotis, S., Hébraud, M., Nychas, G.-J., & Skandamis, P. N. (2023). Influence of temperature on regulation of key virulence and stress response genes in Listeria monocytogenes biofilms. Food Microbiology, 111, Article 104190. https://doi.org/10.1016/j.fm.2022.104190 Prabhukhot, G. S., Eggleton, C. D., Kim, M., & Patel, J. (2024). Impact of surface topography and hydrodynamic flow conditions on single and multispecies biofilm formation by Escherichia coli O157: H7 and Listeria monocytogenes in presence of promotor bacteria. Lwt, 116240. https://doi.org/10.1016/j.lwt.2024.116240 Prabhukhot, G. S., Eggleton, C. D., Vinyard, B., & Patel, J. (2024). Using bio-inline reactor to evaluate sanitizer efficacy in removing dual-species biofilms formed by Escherichia coli O157: H7 and Listeria monocytogenes. Journal of Food Protection. , Article 100314. https://doi.org/10.1016/j.jfp.2024.100314 Puga, C., Orgaz, B., Muñoz, S., & SanJose, C. (2015). Cold stress and presence of Pseudomonas fluorescens affect Listeria monocytogenes biofilm structure and response to chitosan. Molecular Genetic Medicine, 9, 1–6. Puga, C. H., Dahdouh, E., SanJose, C., & Orgaz, B. (2018). Listeria monocytogenes colonizes Pseudomonas fluorescens biofilms and induces matrix over-production. Frontiers in Microbiology, 9, 1706. https://doi.org/10.3389/fmicb.2018.01706 Redding, M., Zheng, J., Mowery, J., Gu, G., Bolten, S., Luo, Y., & Nou, X. (2024). Microscopic and transcriptomic characterization of Listeria monocytogenes aggregation and biofilm formation in cantaloupe juice. Food Control, 158, Article 110243. https://doi.org/10.1016/j.foodcont.2023.110243 Rieu, A., Briandet, R., Habimana, O., Garmyn, D., Guzzo, J., & Piveteau, P. (2008). Listeria monocytogenes EGD-e biofilms: no mushrooms but a network of knitted chains. Applied and environmental microbiology, 74(14), 4491–4497. https://doi.org/ 10.1128/AEM.00255-08 Rismondo, J., Halbedel, S., & Gründling, A. (2019). Cell shape and antibiotic resistance are maintained by the activity of multiple FtsW and RodA enzymes in Listeria monocytogenes. MBio, 10(4). https://doi.org/10.1128/mbio.01448-19 Rodriguez, A., Autio, W. R., & Mclandsborough, L. A. (2008). Effect of surface roughness and stainless steel finish on Listeria monocytogenes attachment and biofilm formation. Journal of Food Protection, 71(1), 170–175. https://doi.org/10.4315/0362-028X- 71.1.170 Santos, T., Viala, D., Chambon, C., Esbelin, J., & Hébraud, M. (2019). Listeria monocytogenes biofilm adaptation to different temperatures seen through shotgun proteomics. Frontiers in Nutrition, 6, 89. https://doi.org/10.3389/fnut.2019.00089 Sasahara, K. C., & Zottola, E. A. (1993). Biofilm formation by Listeria monocytogenes utilizes a primary colonizing microorganism in flowing systems. Journal of Food Protection, 56(12), 1022–1028. https://doi.org/10.4315/0362-028X-56.12.1022 Schmid, B., Klumpp, J., Raimann, E., Loessner, M. J., Stephan, R., & Tasara, T. (2009). Role of cold shock proteins in growth of Listeria monocytogenes under cold and osmotic stress conditions. Applied and Environmental Microbiology, 75(6), 1621–1627. https://doi.org/10.1128/AEM.02154-08 Shah, M., & Bergholz, T. (2020). Variation in growth and evaluation of cross-protection in Listeria monocytogenes under salt and bile stress. Journal of Applied Microbiology, 129(2), 367–377. https://doi.org/10.1111/jam.14607 Simões, L. C., Gomes, I., Sousa, H., Borges, A., & Simões, M. (2022). Biofilm formation under high shear stress increases resilience to chemical and mechanical challenges. Biofouling, 38(1), 1–12. https://doi.org/10.1080/08927014.2021.2006189 Skowron, K., Wiktorczyk, N., Grudlewska, K., Kwiecińska-Piróg, J., Wałecka- Zacharska, E., Paluszak, Z., & Gospodarek-Komkowska, E. (2019). Drug- susceptibility, biofilm-forming ability and biofilm survival on stainless steel of Listeria spp. strains isolated from cheese. International Journal of Food Microbiology, 296, 75–82. https://doi.org/10.1016/j.ijfoodmicro.2019.02.021 Szlavik, J., Paiva, D. S., Mørk, N., van den Berg, F., Verran, J., Whitehead, K., … Nielsen, D. S. (2012). Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow. International Journal of Food Microbiology, 152(3), 181–188. https://doi.org/10.1016/j.ijfoodmicro.2011.09.006 Takahashi, H., Suda, T., Tanaka, Y., & Kimura, B. (2010). Cellular hydrophobicity of Listeria monocytogenes involves initial attachment and biofilm formation on the surface of polyvinyl chloride. Letters in Applied Microbiology, 50(6), 618–625. https:// doi.org/10.1111/j.1472-765X.2010.02842.x Teh, K. H., Flint, S., Palmer, J., Andrewes, P., Bremer, P., & Lindsay, D. (2014). Biofilm− an unrecognised source of spoilage enzymes in dairy products? International Dairy Journal, 34(1), 32–40. https://doi.org/10.1016/j.idairyj.2013.07.002 Utratna, M., Cosgrave, E., Baustian, C., Ceredig, R. H., & O’Byrne, C. P. (2014). Effects of growth phase and temperature on σB activity within a Listeria monocytogenes population: Evidence for RsbV-independent activation of σB at refrigeration temperatures. BioMed Research International, 2014(1), Article 641647. https://doi. org/10.1155/2014/641647 Vazquez-Armenta, F., Hernandez-Oñate, M., Martinez-Tellez, M., Lopez-Zavala, A., Gonzalez-Aguilar, G., Gutierrez-Pacheco, M., & Ayala-Zavala, J. (2020). Quercetin repressed the stress response factor (sigB) and virulence genes (prfA, actA, inlA, and inlC), lower the adhesion, and biofilm development of L. monocytogenes. Food Microbiology, 87, Article 103377. https://doi.org/10.1016/j.fm.2019.103377 Vázquez-Boland, J. A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G., Goebel, W., … Kreft, J. R. (2001). Listeria pathogenesis and molecular virulence determinants. Clinical Microbiology Reviews, 14(3), 584–640. https://doi.org/ 10.1128/cmr.14.3.584-640.2001 van der Veen, S., & Abee, T. (2010). Importance of SigB for Listeria monocytogenes static and continuous-flow biofilm formation and disinfectant resistance. Applied and Environmental Microbiology, 76(23), 7854–7860. https://doi.org/10.1128/ AEM.01519-10 Wang, H., Feng, M., Anwar, T. M., Chai, W., Ed-Dra, A., Kang, X., … Li, Y. (2023). Change in antimicrobial susceptibility of Listeria spp. in response to stress conditions. Frontiers in Sustainable Food Systems, 7, Article 1179835. https://doi.org/10.3389/ fsufs.2023.1179835 Wang, Y., Sun, L., Hu, L., Wang, Z., Wang, X., & Dong, Q. (2022). Adhesion and kinetics of biofilm formation and related gene expression of Listeria monocytogenes in response to nutritional stress. Food Research International, 156, Article 111143. https://doi.org/10.1016/j.foodres.2022.111143 Wiktorczyk-Kapischke, N., Skowron, K., Grudlewska-Buda, K., Wałecka-Zacharska, E., Korkus, J., & Gospodarek-Komkowska, E. (2021). Adaptive response of Listeria monocytogenes to the stress factors in the food processing environment. Frontiers in Microbiology, 12, Article 710085. https://doi.org/10.3389/fmicb.2021.710085 Wiktorczyk-Kapischke, N., Skowron, K., Wałecka-Zacharska, E., Grudlewska-Buda, K., Wnuk, K., Buszko, K., & Gospodarek-Komkowska, E. (2023). Assessment of the influence of selected stress factors on the growth and survival of Listeria monocytogenes. BMC Microbiology, 23(1), 27. https://doi.org/10.1186/s12866-023- 02766-4 Yamaki, S., Kawai, Y., & Yamazaki, K. (2021). Long filamentous state of Listeria monocytogenes induced by sublethal sodium chloride stress poses risk of rapid increase in colony-forming units. Food Control, 124, Article 107860. https://doi.org/ 10.1016/j.foodcont.2020.107860 Zhou, G., Dong, P., Luo, X., Zhu, L., Mao, Y., Liu, Y., & Zhang, Y. (2024). Combined effects of cold and acid on dual-species biofilms of Pseudomonas fluorescens and Listeria monocytogenes under simulated chilled beef processing conditions. Food Microbiology, 117, Article 104394. https://doi.org/10.1016/j.fm.2023.104394 Zhu, Q., Gooneratne, R., & Hussain, M. A. (2017). Listeria monocytogenes in fresh produce: Outbreaks, prevalence and contamination levels. Foods, 6(3), 21. https://doi.org/ 10.3390/foods6030021 K. Pant et al. Food Research International 221 (2025) 117190 10 https://doi.org/10.1016/j.fm.2019.02.002 https://doi.org/10.1016/j.fm.2019.02.002 https://doi.org/10.1016/j.ijfoodmicro.2017.12.020 https://doi.org/10.1016/j.ijfoodmicro.2017.12.020 https://doi.org/10.1016/j.foodcont.2005.06.002 https://doi.org/10.1016/j.foodcont.2005.06.002 https://doi.org/10.1016/j.fm.2022.104190 https://doi.org/10.1016/j.lwt.2024.116240 https://doi.org/10.1016/j.jfp.2024.100314 http://refhub.elsevier.com/S0963-9969(25)01528-5/rf0205 http://refhub.elsevier.com/S0963-9969(25)01528-5/rf0205 http://refhub.elsevier.com/S0963-9969(25)01528-5/rf0205 https://doi.org/10.3389/fmicb.2018.01706 https://doi.org/10.1016/j.foodcont.2023.110243 https://doi.org/10.1128/AEM.00255-08 https://doi.org/10.1128/AEM.00255-08 https://doi.org/10.1128/mbio.01448-19 https://doi.org/10.4315/0362-028X-71.1.170 https://doi.org/10.4315/0362-028X-71.1.170 https://doi.org/10.3389/fnut.2019.00089 https://doi.org/10.4315/0362-028X-56.12.1022 https://doi.org/10.1128/AEM.02154-08 https://doi.org/10.1111/jam.14607 https://doi.org/10.1080/08927014.2021.2006189 https://doi.org/10.1016/j.ijfoodmicro.2019.02.021 https://doi.org/10.1016/j.ijfoodmicro.2011.09.006 https://doi.org/10.1111/j.1472-765X.2010.02842.x https://doi.org/10.1111/j.1472-765X.2010.02842.x https://doi.org/10.1016/j.idairyj.2013.07.002 https://doi.org/10.1155/2014/641647 https://doi.org/10.1155/2014/641647 https://doi.org/10.1016/j.fm.2019.103377 https://doi.org/10.1128/cmr.14.3.584-640.2001 https://doi.org/10.1128/cmr.14.3.584-640.2001 https://doi.org/10.1128/AEM.01519-10 https://doi.org/10.1128/AEM.01519-10 https://doi.org/10.3389/fsufs.2023.1179835 https://doi.org/10.3389/fsufs.2023.1179835 https://doi.org/10.1016/j.foodres.2022.111143 https://doi.org/10.3389/fmicb.2021.710085 https://doi.org/10.1186/s12866-023-02766-4 https://doi.org/10.1186/s12866-023-02766-4 https://doi.org/10.1016/j.foodcont.2020.107860 https://doi.org/10.1016/j.foodcont.2020.107860 https://doi.org/10.1016/j.fm.2023.104394 https://doi.org/10.3390/foods6030021 https://doi.org/10.3390/foods6030021 Shear stress adaptation of Listeria monocytogenes in mono and dual-species biofilms 1 Introduction 2 Materials and methods 2.1 Bacterial strains and culture media used 2.2 Biofilm formation in static and turbulent conditions 2.3 Reynolds number for turbulent flow 2.4 Cross-adaptation: cells from planktonic, static, and turbulent flow 2.4.1 Motility 2.4.2 Adhesion to stainless-steel surface 2.4.3 Biofilm-forming ability of harvested cells 2.5 Epifluorescence- morphology of the cells 2.6 Fluorescence in situ hybridization (FISH) and confocal microscopy 2.7 Relative gene expression 2.8 Statistical analysis 3 Results 3.1 Biofilm formation under turbulent flow 3.2 Spatial arrangement and morphology of the cells 3.3 Cross-adaptation and correlation 3.4 Relative gene expression 4 Discussion 5 Conclusion CRediT authorship contribution statement Declaration of competing interest Data availability References